Plant and Cell Physiology Advance Access originally published online on February 28, 2008
Plant and Cell Physiology 2008 49(4):633-640; doi:10.1093/pcp/pcn036
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DCW11, Down-Regulated Gene 11 in CW-Type Cytoplasmic Male Sterile Rice, Encoding Mitochondrial Protein Phosphatase 2C is Related to Cytoplasmic Male Sterility
Laboratory of Environmental Biotechnology, Graduate School of Agricultural Science, Tohoku University, 1-1 Tsutumidori-Amamiyamachi, Aoba-ku, Sendai, 981-8555 Japan
*Corresponding author: E-mail, torikin{at}bios.tohoku.ac.jp; Fax, +81-22-717-8834.
| Abstract |
|---|
|
|
|---|
Causes of cytoplasmic male sterility (CMS) in plants have been studied for two decades, and mitochondrial chimeric genes have been predicted to induce CMS. However, it is unclear what happens after CMS-associated proteins accumulate in mitochondria. In our previous study of microarray analysis, we found that 140 genes are aberrantly regulated in anthers of CW-type CMS of rice (Oryza sativa L.). In the present study, we investigated DCW11, one of the down-regulated genes in CW-CMS encoding a protein phosphatase 2C (PP2C). DCW11 mRNA was preferentially expressed in anthers, with the highest expression in mature pollen. As predicted by the N-terminal sequence, DCW11 signal peptide–green fluorescent protein (GFP) fusion protein was localized in mitochondria. Knockdown of DCW11 in wild-type rice by RNA interference caused a major loss of seed-set fertility, without visible defect in pollen development. Since this knockdown phenotype resembled that of CW-CMS, we concluded that the down-regulation of DCW11 is correlated with CW-CMS. This idea was supported by the up-regulation of alternative oxidase 1a (AOX1a), which is known to be regulated by mitochondrial retrograde signaling, in DCW11 knockdown lines. Down-regulation of DCW11 and up-regulation of AOX1a were also observed in two other types of rice CMS. Our result indicates that DCW11 could play a role as a mitochondrial signal transduction mediator in pollen germination.
Keywords: Cytoplasmic male sterility (CMS) - Mitochondrial retrograde signaling - Oryza sativa - Protein phosphatase 2C
Abbreviations: AOX, alternative oxidase; CaMV, cauliflower mosaic virus; CMS, cytoplasmic male sterility; DCW, down-regulated in CW-CMS; GFP, green fluorescent protein; PP2C, protein phosphatase 2C; PPR, pentatricopeptide repeat; RNAi, RNA interference; RT–PCR, reverse transcription–PCR; UTR, untranslated region.
| Introduction |
|---|
|
|
|---|
Cytoplasmic male sterility (CMS) is a maternally inherited trait that results in the inability of plants to produce functional pollen, and it is widely utilized for F1 hybrid breeding. Beside their commercial use, CMS studies contribute to a better understanding of the plant nuclear–mitochondrial intracellular genomic barrier. For instance, many researchers have concluded that an aberrant chimeric gene in mitochondria possibly induces CMS in various plant species. On the contrary, nuclear fertility restorers have been genetically identified to ameliorate the ectopic protein derived from a chimeric gene (Hanson and Bentolila 2004
Retrograde responses derived from mitochondrial stress have been widely investigated in yeast and mammalian cells (Butow and Avadhani 2004
). The RTG pathway is one of the most investigated systems of mitochondrial retrograde signaling. This pathway is characterized by two basic helix–loop–helix-leucine zipper (bHLH-Zip) transcription factors, Rtg1p and Rtg3p, that are thought to function in activation of the retrograde genes. In addition, the ATP-binding protein Rtg2g acts as the mediator of mitochondrial signals to Rtg1p and Rtg3p (Sekito et al. 2000
). Thus, genes that possess the function of signaling and transcriptional regulation are likely to be involved in retrograde signaling. It is likely that pathways similar to the yeast or animal stress-derived mitochondrial retrograde response exist in plants. Mitochondrial-mediated signaling in wild-type plants is perhaps essential for normal male sporophyte or gametophyte development. Such factors related to retrograde signaling could be revealed as CMS downstream factors in a comprehensive transcriptomic study of CMS.
Among several types of CMS in rice, we have been studying three types of gametophytic CMS: BT-CMS, LD-CMS and CW-CMS (for a review, see Fujii et al. 2008
). BT-CMS originated from indica variety Chinsurah boro II (Shinjyo 1975
). Although BT-CMS has been studied most extensively (Iwabuchi et al. 1993
, Kazama and Toriyama 2003
, Wang et al. 2006
), we thought it was unsuitable for a comprehensive transcriptomic study because the pollen of the BT-CMS line shows apparent reduction of starch content and abnormal morphology. Pollen grains of the LD-CMS line, which originated from the Burnese cultivar Lead Rice, also show reduction of starch content and abnormal morphology. In contrast, pollen of the CW-CMS line, which is derived from Oryza rufipogon Griff., W1 strain, appeared to be normal but lacks pollen germination ability (Fujii and Toriyama 2005
). Thus, we considered that CW-CMS should be the model for a rice CMS transcriptomic study using a microarray, so that the effects of morphological abnormality are minimally reflected. As a result, we have obtained 140 aberrantly regulated genes in a CW-CMS plant (Fujii et al. 2007
). The genes differentially regulated in our CMS microarray were designated as up-regulated gene in CW-CMS (UCW) or down-regulated gene in CW-CMS (DCW). In order to identify the core factors that mediate retrograde signaling in CMS, or CMS downstream factors, we applied a reverse genetic approach in UCW and DCW genes.
In this study, we analyzed the expressional and functional characters of one of the DCW genes, DCW11, which encodes a protein phosphatase 2C (PP2C) gene. The possible role of DCW11 in CMS induction mechanism of rice is discussed.
| Results |
|---|
|
|
|---|
DCW11 encodes a mitochondrial protein phosphatase 2C protein
DCW11 (accession No. AK069289 [GenBank] in the rice full-length cDNA database, KOME, http://cdna01.dna.affrc.go.jp/cDNA/) was identified as a down-regulated gene under the CW-CMS background by our microarray analysis (Fujii et al. 2007
|
In Arabidopsis, the PP2C family consists of 76 members (Schweighofer et al. 2004
The PSORT computer program (http://psort.nibb.ac.jp/) and the Mitoprot web site (http://ihg.gsf.de/ihg/mitoprot.html) predicted that DCW11 would be imported into mitochondria, and that the first 59 amino acids are possibly mitochondrial targeting signal peptides (Fig. 1, broken line). In order to verify that DCW11 localizes in mitochondria, we fused the fragment for putative signal peptides to a gene for green fluorescent protein (GFP) under the control of the cauliflower mosaic virus (CaMV) 35S promoter, and introduced it into tobacco BY-2 cells by Agrobacterium-mediated transformation. As expected from the sequence, DCW11 signal peptide–GFP fusion protein was shown to co-localize with the Mito Tracker Red signal (Fig. 2). DCW11, therefore, was confirmed to localize in mitochondria.
|
DCW11 is preferentially expressed in anthers, with the highest accumulation in mature pollen
The expression specificity of DCW11 in wild-type rice was monitored in anthers at the tetrad stage, uninucleate microspore stage, bicellular pollen stage and tricellular pollen stage, as well as in isolated tricellular pollen, stigmas, seeds, seedlings and roots using quantitative reverse transcription–PCR (RT–PCR) (Fig. 3). Expression of DCW11 increased during pollen development in anthers from the tetrad stage to the tricellular pollen stage. The highest accumulation of DCW11 mRNA was observed in tricellular pollen. The expression of DCW11 was not detected in stigmas, seeds, seedlings or roots. This expression profile indicates that DCW11 plays a role in pollen development.
|
Knockdown of DCW11 in Taichung 65 results in reduced seed sets and AOX1a up-regulation
To gain insight into the nature of DCW11 involvement in CMS, we produced DCW11 knockdown plants by the RNA interference (RNAi) method. The DCW11 cDNA-specific region in the 3' untranslated region (UTR) of the gene was cloned for utilization as the trigger for RNAi. We obtained seven independent RNAi transgenic lines. In five transgenic plants, expression of DCW11 was shown to be knocked down to 4–38% in comparison with that of the wild-type in the T0 generation (Fig. 4A, KDDCW11-1, KDDCW11-3, KDDCW11-4, KDDCW11-5, KDDCW11-7). Seed sets of knockdown lines were reduced to 4–56%, whereas the control plants with β-glucuronidase (gus) genes were reduced to 75%. Since reduced seed fertility is often observed in the transgenic T0 generation, we planted eight plants per line for the T1 generation, of which DCW11 mRNA was successfully down-regulated in the T0 generation. The seed sets in the T1 generation were reduced to 15–49%, which was almost the same as that in the T0 generation (Fig. 4B). T1 plants that lost the RNAi transgenes showed normal seed-set fertility and normal DCW11 expression, which proved that reduction of seed set in knockdown plants was caused by DCW11 mRNA down-regulation. Since DCW11 mRNA was barely detected in stigmas or seeds (Fig. 2), we considered that down-regulation of DCW11 caused male sterility but did not cause dysfunction in female organs or seed maturation. This was supported by the fact that we obtained F1 seeds by crossing wild-type pollen onto DCW11 knockdown plants (data not shown). We could not find any morphological defects in the pollen of DCW11 knockdown plants under light microscopy (data not shown). The values of pollen stainability were >85% in the T1 generation of DCW11 knockdown plants, which was the same as that observed in the CW-CMS line (Fig. 4C). We suspected that DCW11 functions in pollen germination ability. This phenotype resembled CW-CMS, in which the pollen looks normal until it fails to germinate on the stigma. These results led us to believe that DCW11 could be related to CW-CMS.
|
In order to obtain further evidence, we investigate the expression levels of AOX1a mRNA in DCW11 knockout lines. AOX1a is known to be up-regulated in the mitochondrial complex I mutant of tobacco (Sabar et al. 2000
DCW11 is down-regulated in other CMS mature anthers
To determine if DCW11 is involved in other CMS systems in rice, we checked the expression level of DCW11 in mature anthers of BT-CMS and LD-CMS lines, both of which exhibit the pollen abortion phenotype (Fig. 4A). We also isolated total RNA from uninucleate microspores, bicellular pollen and tricellular pollen of BT-CMS and LD-CMS lines, as well as CW-CMS and Taichung 65. The resulting total RNA was subjected to quantitative real-time RT–PCR. As a result, down-regulation of DCW11 was evident in pollen at the tricellular stage in all three CMS cytoplasms, but not in uninucleate microspores or bicellular pollen (Fig. 5). From these results, we expect that transcriptional regulation of DCW11 is common in all these CMS systems.
|
| Discussion |
|---|
|
|
|---|
DCW11 is involved in pollen germination
DCW11 encodes PP2C targeted to mitochondria. The function of DCW11 or an ortholog of Arabidopsis has not yet been elucidated. We have analyzed the expressional and functional characters of DCW11 in wild-type rice. Knockdown of DCW11 resulted in reduced seed set although pollen grains of the knockdown lines were visibly normal.
To date, there have been large numbers of Arabidopsis male gametophyte mutants identified, with morphologically unaffected pollen but deficient in male transmission of the mutant allele. A calmodulin-binding protein mutant no pollen germination1 exhibited complete loss of T-DNA transmission through male gametophytes, although no obvious defects were observed in pollen development (Golovkin and Reddy 2003
). Johnson et al. (2004
) screened a large number of Arabidopsis T-DNA tag-lines and identified in total 32 hapless mutants, which displayed distorted genotype segregation. Twenty-nine of them were deficient in steps later than pollen germination rather than pollen development. SETH1 and SETH2 are genes encoding glycosylphosphatidylinositol-anchoring proteins, and essential for maintenance of polarized pollen tube growth (Lalanne et al. 2004
). To the best of our knowledge, there have been no reports demonstrating that a PP2C-encoding gene is required for the pollen germination process. Although we have not yet determined whether DCW11 possesses PP2C activity or not, our results demonstrated that DCW11 mRNA is accumulated in mature pollen and functions in pollen germination. Additional information about the pollen tube growth mechanism could be obtained by searching the signaling transduction components that DCW11 is involved in.
Repression of DCW11 results in AOX1a up-regulation
Expression of AOX1a is well known to be regulated by mitochondrial retrograde signaling (Djajanegara et al. 2002
). Zarkovic et al. (2005
) designed a forward genetic screening to isolate the mitochondrial retrograde regulation factor using mutagenized Arabidopsis carrying the firefly luciferase gene fused to the AOX1a promoter, resulting in the Arabidopsis plants with mutations in the genes related to mitochondrial retrograde regulation failing to activate the AOX1a promoter under antimycin A treatment. In our case, such a forward genetic approach using a reporter gene was difficult due to the nature of CMS. We therefore applied a reverse genetic approach in DCW genes. Since knockdown of DCW11 resulted in AOX1a up-regulation in this study (Fig. 4D), DCW11 could be participating in suppression of AOX1a mRNA expression under normal conditions, or the knockdown of DCW11 was causative of the CMS-like effect. This is also supported by the fact that AOX1a is up-regulated in BT-CMS and LD-CMS, in which DCW11 was down-regulated (Fig. 4D). To the best of our knowledge, there have been no reports on AOX1a negative regulators, although Zarkovic (2005
) has indicated the existence of a candidate positive regulator. Understanding the molecular functions of DCW11 would help us interpret the regulatory network of AOX1a and retrograde signaling in plants.
In mammals, a recent study on novel mitochondrial matrix-localized PP2C, PP2Cm, revealed that knockdown resulted in cell death associated with loss of mitochondrial membrane potential (Lu et al. 2007
). Although DCW11 had no significant similarities to human PP2Cm (data not shown), we are not able to rule out the possibility of DCW11 participating in a part of the cell death program. Considering that DCW11 homologous At5g53140 in Arabidopsis belongs to group F of PP2C division and its function was previously unidentified, some of the members of group F could be related in mitochondrial stress signaling.
DCW11 could be the downstream factor of CMS
Although CMS is caused by genetic incompatibility between nuclei and mitochondria within male reproductive organs, only a few hints are provided for the essentiality of mitochondria in pollen development from mutant studies. Recently, the Arabidopsis mitochondrial complex II mutant sdh1-1 was isolated and was shown to have deficiency in both male and female gametophyte development (Leon et al. 2007
). Pollen of the mutants develops normally until the vacuolated microspore stage, but fails to undergo mitosis I. The result indicates that mitochondrial complex II activity may be indispensable for generating a vegetative nucleus. One of the hapless mutants, hap11, was shown to encode a mitochondrial ATP synthase subunit (Johnson et al. 2004
). In the case of hap11, the pollen tube growth path appears normal, but the tube fails to enter the micropyle. Since mitochondria are ubiquitous organelles and provide energy to all kinds of cells, mitochondrial mutants should exhibit embryo lethality or early developmental dysfunctions as they do in the case of the maize empty pericarp4 (EMP4) mutant (Gutierrez-Marcos et al. 2007
). These authors showed that EMP4 encodes a mitochondrial pentatricopeptide repeat (PPR) protein. Many mitochondrial PPR mutants are embryonic lethal in Arabidopsis, indicating that proper mitochondrial function is critical for early plant development (Lurin et al. 2004
).
Thus, why male-specific defects are observed in CMS is quite interesting. There might be a special function of mitochondria in male organ development rather than energy production, such as regulation of nuclear genes required for pollen development (for a review, see Hanson and Bentolila 2004
). Since this knockdown phenotype of a defect in pollen germination ability resembled that of CW-CMS, we have concluded that the down-regulation of DCW11 is strongly correlated with CW-CMS. DCW11 could be involved in mitochondrial signal transduction in pollen development, especially in acquisition of germination ability.
| Materials and Methods |
|---|
|
|
|---|
Plant materials
Oryza sativa L. japonica cultivar Taichung 65 was used as the wild type throughout the study. A BT-CMS line was obtained from a successive backcross of Chinsurah Boro II and Taichung 65 (Shinjyo 1975
Plasmid construction and plant transformation
DCW11 RNAi constructs driven by the maize ubiquitin promoter were produced using the pANDA vector provided by Dr. Miki and Dr. Shimamoto, following their protocols (Miki and Shimamoto 2004
). A gene-specific region of the 400 bp 3' UTR of DCW11 (accession No. AK069289
[GenBank]
in the rice full-length cDNA database, KOME http://cdna01.dna.affrc.go.jp/cDNA/) was PCR cloned by the primer set 5'-CACCCCCTTGCGAAAACAGAAGAC-3' and 5'-CCGTAATGGCAGGTAATTAG-3'. Nucleotides CACC were added to the original DCW11 sequence for cloning into TOPO vector (Invitrogen, Carlsbad, CA, USA). The resulting RNAi construct was introduced into Agrobacterium tumefaciens EHA105, and further introduced into plants by the method described by Yokoi et al. (1997
). We also developed rice lines with the gus gene driven by the maize ubiquitin promoter as a negative control.
Pollen stainability
Spikelets 1 d before anthesis were harvested, and pollen grains were stained with 1% (w/v) iodine–potassium iodide solution. The numbers of darkly stained pollen grains were counted for >200 pollen grains per spikelet. Pollen stainability was calculated as the average of the values of six spikelets. The seed set percentage was calculated as the average of that of the five panicles for each plant.
Quantitative RT–PCR analysis
Total RNA from various stages of anthers, pollen, stigmas, seeds, seedlings and roots was extracted using RNeasy (Qiagen, Tokyo, Japan) according to the manufacturer's instructions. DNA contamination was eliminated by treatment of RNase-free DNase I (TAKARA-BIO INC., Ohtsu, Japan). cDNA synthesis was accomplished using the ReverTraAce (TOYOBO, Osaka, Japan). PCR was performed for three biological replicates, using SYBR Premix Ex Taq (TAKARA BIO INC.) and Thermal Cycler Dice Real Time System TP800 (TAKARA BIO INC.).
RT–PCR was performed using the specific set of primers for each amplification reaction as follows: 5'-ATGAAGACTTGGAATGCCTC-3' and 5'-CCGTAATGGCAGGTAATTAG-3' for DCW11; 5'-GTCTACTGCCGAGGATTTGCATCAC-3' and 5'-CCGATACAGCTAAAGAGCTCTC-3' for AOX1a (accession No. AK064040 [GenBank] in the rice full-length cDNA database, KOME, http://cdna01.dna.affrc.go.jp/cDNA/); 5'-TACAACGGTTGGCGTCGCAC-3' and 5'AACTTGCGCACACGGTCCAG-3' for tubulin alpha-1 chain (accession No. AK069140 [GenBank] in the rice full-length cDNA database, KOME, http://cdna01.dna.affrc.go.jp/cDNA/).
Transformation of tobacco BY-2 cells
To analyze the DCW11 cellular localization, a 198 bp fragment encoding predicted signal peptides was PCR cloned by primers FORWARD: GGATCCATGGTATGCTTCGCTAGCCT and REVERSE: GGATCCGGAGTCGAGCATCATCCTGG. A BamHI site was added to the original DCW11 sequence for cloning into the CaMV 35S- and GFP-containing binary vector. Transformation of BY-2 cells was performed as described by Shaul et al. (1996
). Transformed cells were selected by kanamycin treatment, and counterstained by Mito Tracker Red (Invitrogen). Cells were observed under fluorescent microscopy.
| Funding |
|---|
|
|
|---|
The Ministry of Agriculture, Forestry and Fisheries of Japan (Integrated research project for plant, insect and animal using genome technology QT-2007); the Ministry of Education, Science, Sports and Culture, Japan Grant-in-Aid for Special Research on Priority Areas (No. 18075002). S.F. is the recipient of Research Fellowships of the Japan Society for the promotion of Science for Young Scientists.
| Acknowledgments |
|---|
|
|
|---|
We are grateful to Dr. Kiyoyuki Miura at National Agricultural Research Center for providing seeds of LD-CMS lines. pANDA vector was kindly provided by Dr. Miki and Dr. Shimamoto from the Nara Institute of Science and Technology.
| References |
|---|
|
|
|---|
Butow RA, Avadhani NG. Mitochondrial signaling: the retrograde response. Mol. Cell (2004) 14:1–15.[CrossRef][Web of Science][Medline]
Djajanegara I, Finnegan PM, Mathieu C, McCabe T, Whelan J, Day DA. Regulation of alternative oxidase gene expression in soybean. Plant Mol. Biol. (2002) 50:735–742.[CrossRef][Web of Science][Medline]
Fujii S, Kazama T, Toriyama K. Molecular studies on cytoplasmic male sterility-related genes and restorer genes in rice. In: Rice Biology in the Genomics Era—Hirano HY, Hirai A, Sano Y, Sasaki T, eds. (2008) Berlin: Spriger-Verlag. 205–216.
Fujii S, Komatsu S, Toriyama K. Retrograde regulation of nuclear gene expression in CW-CMS of rice. Plant Mol. Biol. (2007) 63:405–417.[CrossRef][Web of Science][Medline]
Fujii S, Toriyama K. Molecular mapping of the fertility restorer gene for rice ms-CW-type cytoplasmic male sterility of rice. Theor. Appl. Genet. (2005) 111:696–701.[CrossRef][Web of Science][Medline]
Geddy R, Mahe L, Brown GG. Cell-specific regulation of a Brassica napus CMS-associated gene by a nuclear restorer with related effects on a floral homeotic gene promoter. Plant J. (2004) 41:333–345.[Web of Science]
Golovkin M, Reddy AS. A calmodulin-binding protein from Arabidopsis has an essential role in pollen germination. Proc. Natl Acad. Sci. USA (2003) 100:10558–10563.
Gutiérrez-Marcos JF, Dal Prà M, Giulini A, Costa LM, Gavazzi G, et al. empty pericarp4 encodes a mitochondrion-targeted pentatricopeptide repeat protein necessary for seed development and plant growth in maize. Plant Cell (2007) 19:196–210.
Hanson MR, Bentolila S. Interactions of mitochondrial and nuclear genes that affect male gametophyte development. Plant Cell (2004) 16:S154–S169.
Iwabuchi M, Kyozuka J, Shimamoto K. Processing followed by complete editing of an altered mitochondrial atp6 RNA restores fertility of cytoplasmic male sterile rice. EMBO J. (1993) 12:1437–1446.[Web of Science][Medline]
Johnson MA, von Besser K, Zhou Q, Smith E, Aux G, Patton D, Levin JZ, Preuss D. Arabidopsis hapless mutations define essential gametophytic functions. Genetics (2004) 168:971–982.
Kazama T, Toriyama K. A pentatricopeptide repeat-containing gene that promotes the processing of abberant atp6 RNA of cytoplasmic male-sterile rice. FEBS Lett. (2003) 544:99–102.[CrossRef][Web of Science][Medline]
Kerk D, Bulgrien J, Smith DW, Barsam B, Veretnik S, Gribskov M. The complement of protein phosphatase catalytic subunits encoded in the genome of Arabidopsis. Plant Physiol. (2002) 129:908–925.
Lalanne E, Honys D, Johnson A, Borner GH, Lilley KS, Dupree P, Grossniklaus U, Twell D. SETH1 and SETH2, two components of the glycosylphosphatidylinositol anchor biosynthetic pathway, are required for pollen germination and tube growth in Arabidopsis. Plant Cell (2004) 16:229–240.
León G, Holuigue L, Jordana X. Mitochondrial complex II is essential for gametophyte development in Arabidopsis. Plant Physiol. (2007) 143:1534–1546.
Linke B, Nothnagel T, Borner T. Flower development in carrot CMS plants: mitochondria affect the expression of MADS box genes homologous to GLOBOSA and DEFICIENS. Plant J. (2003) 34:27–37.[CrossRef][Web of Science][Medline]
Lu G, Ren S, Korge P, Choi J, Dong Y, Weiss J, Koehler C, Chen J, Wang J. A novel mitochondrial matrix serine/threonine protein phosphatase regulates the mitochondria permeability transition pore and is essential for cellular survival and development. Genes Dev. (2007) 21:784–796.
Lurin C, Andres C, Aubourg S, Bellaoui M, Bitton F, et al. Genome-wide analysis of Arabidopsis pentatricopeptide repeat proteins reveals their essential role in organelle biogenesis. Plant Cell (2004) 16:2089–2103.
Miki D, Shimamoto K. Simple RNAi vectors for stable and transient suppression of gene function in rice. Plant Physiol. (2004) 45:490–495.
Murai K, Takumi S, Koga H, Ogihara Y. Pistillody, homeotic transformation of stamens into pistil-like structures, caused by nuclear–cytoplasm interaction in wheat. Plant J. (2002) 29:169–181.[CrossRef][Web of Science][Medline]
Sabar M, De Paepe R, de Kouchkovsky Y. Complex I inpairment, respiratory compensations and photosynthetic decrease in nuclear and mitochondrial male sterile mutants of Nicotiana sylvestris. Plant Physiol. (2000) 124:1239–1249.
Schweighofer A, Hirt H, Meskiene I. Plant PP2C phosphatases: emerging functions in stress signaling. Trends Plant Sci. (2004) 9:236–243.[CrossRef][Web of Science][Medline]
Sekito T, Thomson J, Butow RA. Mitochondria-to-nuclear signaling is regulated by the subcellular localization of the transcription factors Rtg1p and Rtg3p. Mol. Biol. Cell (2000) 11:2103–2115.
Shaul O, Nironov V, Burssens S, Montague MV, Inze D. Two Arabidopsis cyclin promoters mediate distinct transcriptional oscillation in synchronized tobacco BY-2 cells. Proc. Natl Acad. Sci. USA (1996) 93:4868–4872.
Shinjyo C. Genetical studies of cytoplasmic male sterility and fertility restoration in rice, Oryza sativa L. Sci. Bull. Coll. Agr. Univ. Ryukyus (1975) 22:1–57.
Teixeira RT, Farbos I, Glimelius K. Expression levels of meristem identity and homeotic genes are modified by nuclear–mitochondrial interactions in alloplasmic male-sterile lines of Brassica napus. Plant J. (2005) 42:731–742.[CrossRef][Web of Science][Medline]
Toriyama K, Hinata K. Anther culture application to breeding of a restorer for male-sterile cytoplasm of wild rice [ms-CW]. Jpn. J. Breed. (1987) 37:469–473.
Wang Z, Zou Y, Li X, Zhang Q, Chen L, et al. Cytoplasmic male sterility of rice with boro II cytoplasm is caused by a cytotoxic peptide and is restored by two related PPR motif genes via distinct modes of mRNA silencing. Plant Cell (2006) 18:676–687.
Yokoi S, Tsuchiya T, Toriyama K, Hinata K. Tapetum-specific expression of the Osg6B promoter–β-glucuronidase gene in transgenic rice. Plant Cell Rep. (1997) 16:363–367.[CrossRef][Web of Science]
Zarkovic J, Anderson SL, Rhoads DM. A reporter gene system used to study developmental expression of alternative oxidase and isolate mitochondrial retrograde regulation mutants in Arabidopsis. Plant Mol. Biol. (2005) 57:871–888.[CrossRef][Web of Science][Medline]
Zubko MK. Mitochondrial tuning fork in nuclear homeotic functions. Trends Plant Sci. (2004) 9:61–64.[CrossRef][Web of Science][Medline]
(Received December 10, 2007; Accepted February 25, 2008)
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. Fujii, M. Yamada, and K. Toriyama Cytoplasmic Male Sterility-Related Protein Kinase, OsNek3, is Regulated Downstream of Mitochondrial Protein Phosphatase 2C, DCW11 Plant Cell Physiol., April 1, 2009; 50(4): 828 - 837. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fujii and K. Toriyama Genome Barriers between Nuclei and Mitochondria Exemplified by Cytoplasmic Male Sterility Plant Cell Physiol., October 1, 2008; 49(10): 1484 - 1494. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





