Plant and Cell Physiology Advance Access originally published online on August 23, 2007
Plant and Cell Physiology 2007 48(9):1263-1274; doi:10.1093/pcp/pcm107
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Rapid Paper |
Disease Resistance against Magnaporthe grisea is Enhanced in Transgenic Rice with Suppression of 
-3 Fatty Acid Desaturases
1Department of Biology, Faculty of Sciences, Kyushu University, Hakozaki, Fukuoka, 812-8581 Japan
2College of Agriculture, Ibaraki University. 3-21-1 Chuo, Ami, Ibaraki, 300-0393 Japan
3RIKEN, The Institute of Physical and Chemical Research, 2-1 Hirosawa, Wako-shi, Saitama, 351-0198 Japan
4CEA, Cadarache, DSV-DEVM, Laboratoire des Échanges Membranaires et Signalisation, 13108 Saint-Paul-Lez Durance Cedex, France
5Plant-Microbe Interactions Research Unit, National Institute of Agrobiological Sciences (NIAS), Kannon-dai, Tsukuba, Ibaraki, 305-8602 Japan
*Corresponding author: E-mail, koibascb{at}mbox.nc.kyushu-u.ac.jp; Fax, +81-92-642-2621.
 |
Abstract |
|---|
 Top Abstract IntroductionResultsDiscussionMaterials and MethodsAcknowledgmentsReferences |
|---|
Linolenic acid (18:3) is the most abundant fatty acid in plant membrane lipids and is a source for various oxidized metabolites, called oxylipins. 18:3 and oxylipins play important roles in the induction of defense responses to pathogen infection and wound stress in Arabidopsis. However, in rice, endogenous roles for 18:3 and oxylipins in disease resistance have not been confirmed. We generated 18:3-deficient transgenic rice plants (F78Ri) with co-suppression of two
-3 fatty acid desaturases, OsFAD7 and OsFAD8. that synthesize 18:3. The F78Ri plants showed enhanced resistance to the phytopathogenic fungus Magnaporthe grisea. A typical 18:3-derived oxylipin, jasmonic acid (JA), acts as a signaling molecule in defense responses to fungal infection in Arabidopsis. However, in F78Ri plants, the expression of JA-responsive pathogenesis-related genes, PBZ1 and PR1b, was induced after inoculation with M. grisea, although the JA-mediated wound response was suppressed. Furthermore, the application of JA methyl ester had no significant effect on the enhanced resistance in F78Ri plants. Taken together, our results indicate that, although suppression of fatty acid desaturases involves the concerted action of varied oxylipins via diverse metabolic pathways, 18:3 or 18:3-derived oxylipins, except for JA, may contribute to signaling on defense responses of rice to M. grisea infection.
Keywords: Fatty acid desaturase — Jasmonic acid — Linolenic acid — Magnaporthe grisea — Oryza sativa — Oxylipin
Abbreviations: 18:3, linolenic acid; DGDG, digalactosyldiacylglycerol; DMSO, dimethylsulfoxide; FAD, fatty acid desaturase; JA, jasmonic acid; MeJA, methyl jasmonate; MGDG, monogalactosyldiacylglycerol; PC, phosphatidylcholine; PE, phosphatidylethanolamine; PG, phosphatidylglycerol; PI, phosphatidylinositol; PR, pathogenesis-related; PUFA, polyunsaturated fatty acid; RNAi, RNA interference; SQDG, sulfoquinovosyldiacylglycerol; TA, trienoic fatty acid
|
Introduction |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsAcknowledgmentsReferences |
|---|
Trienoic fatty acids (TAs) are polyunsaturated fatty acids (PUFAs) that are acylated in membrane lipids, and are the sources of the oxidized metabolites, oxylipins. TAs and oxylipins play various physiological roles in plant responses to abiotic and biotic stresses (Iba 2002
, Turner et al. 2002, Weber 2002, Yaeno et al. 2004). When a plant is exposed to a fungal infection and wound stress, oxylipins are transiently synthesized, and then defense responses, such as the expression of pathogenesis-related (PR) genes and the biosynthesis of antimicrobial compounds, are activated (Seo et al. 1995, Penninckx et al. 1996, McConn et al. 1997). The endogenous roles of oxylipins have been confirmed by the analysis of a TA-deficient fad3 fad7 fad8 mutant in Arabidopsis. For example, this mutant is susceptible to the fungal pathogen Pythium mastophorum and the dipteran insect Bradysia impatiens, and is defective in the wound responses and the induction of PR genes (McConn et al. 1997, Vijayan et al. 1998). It has been confirmed that the loss of the resistance is caused by the deficiency of a typical oxylipin, jasmonic acid (JA), because these phenotypes are restored by the exogenous application of JA methyl ester (MeJA). An intermediate of JA biosynthesis, 12-oxo-phytodienoic acid (OPDA), and C6-compounds derived from PUFAs have also been suggested to induce the expression of PR genes and resistance to fungal infection (Stintzi et al. 2001, Kishimoto et al. 2005).
Compared with dicotyledonous plants, little is known about the function of oxylipins in disease resistance in monocotyledonous plants. In rice, a fungal blast caused by Magnaporthe grisea is a serious disease. After inoculation with M. grisea, the expression of PR genes is induced (Midoh and Iwata 1996, Xiong and Yang 2003, Kim et al. 2004). Some of these PR genes, for example PBZ1 and PR1b, are also induced by JA application (Agrawal et al. 2000, Kim et al. 2004). In addition, the biosynthesis of hydroxy PUFAs that have antimicrobial activity is activated by fungal infection in rice (Ohta et al. 1991). Thus, it has been hypothesized that these oxylipins play various roles in the disease resistance to fungal infection in rice. However, endogenous roles of oxylipins have not been confirmed because there is no oxylipin-biosynthetic rice mutant. Therefore, like the fad3 fad7 fad8 mutant in Arabidopsis, to study the roles of endogenous oxylipins in the defense responses, the analysis of TA-deficient rice plants may be most effective.
Rice represents an ‘18:3 plant’, and has one kind of TA, octadecatrienoic acid (linolenic acid; 18:3) (Toriyama et al. 1988). 18:3 is produced from octadecadienoic acid (linoleic acid; 18:2) by -3 fatty acid desaturase (FAD). In Arabidopsis, there are three FAD isozymes, two of which are chloroplast localized and encoded by the genes AtFAD7 and AtFAD8 (Iba et al. 1993, Gibson et al. 1994). The third is microsome localized and encoded by AtFAD3 (Arondel et al. 1992). In rice, OsFAD3 has been identified and the existence of two more FAD7 homologs has been suggested (Kodama et al. 1997). Recently, a plastidial OsFAD8 gene was identified and characterized (Wang et al. 2006). In this study, we isolated another FAD gene, namely OsFAD7. We generated and analyzed 18:3-deficient transgenic rice (F78Ri) plants with co-suppression of OsFAD7 and OsFAD8.
|
Results |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsAcknowledgmentsReferences |
|---|
Characterization of rice FAD7 genes
To identify rice plastidial FAD genes, we performed a BLAST search of the rice full-length cDNA database KOME (http://cdna01.dna.affrc.go.jp/cDNA/) and found two cDNA fragments. Corresponding cDNA and genomic clones were isolated from rice plants (Oryza sativa cv. Taichung 65) by PCR using the sequences of these fragments to design primers. One cDNA clone was highly homologous to the known OsFAD8 sequence, and another was predicted to encode a novel FAD enzyme. We named this gene OsFAD7. The deduced 1,380 bp open reading frame (ORF) of the OsFAD7 gene encoded 459 amino acid residues (Fig. 1). The OsFAD7 amino acid sequence shared high homology with AtFAD7 (61% identity), AtFAD8 (62% identity) and AtFAD3 (54% identity). OsFAD7 contains N-terminal extension transit peptides, as do OsFAD8, AtFAD7 and AtFAD8. While the exon/intron structure of OsFAD7 resembled that of AtFAD7 and AtFAD8, the number of exons of OsFAD8 is lower than in other FAD genes (Fig. 2A). Phylogenic analysis using the deduced amino acid sequence of several higher plant FADs showed that OsFAD7 is a homolog of the monocot plastidial FADs, such as OsFAD8, ZmFAD7 and ZmFAD8 (Fig. 2B).
|
|
OsFAD8, AtFAD7 and AtFAD8 are mainly expressed in leaves (Nishiuchi et al. 1995
, Wang et al. 2006). Similar to OsFAD8, OsFAD7 was also expressed at high levels in leaves, but at trace levels in roots (data not shown). In rice and Arabidopsis, JA-biosynthetic genes are induced by wounding and JA treatment (Sasaki et al. 2001, Strassner et al. 2002, Agrawal et al. 2003, Stenzel et al. 2003, Haga et al. 2004). The expression of AtFAD7 in leaves, however, is induced by wounding, but not by JA (Nishiuchi et al. 1997). Similarly, OsFAD8 mRNA increased slightly after wounding, but was not affected by JA (Fig. 3). On the other hand, OsFAD7 and OsFAD3 mRNAs increased after wounding and JA treatment, although the timings of the expression were different in these genes.
|
Suppression of FAD genes causes a reduction of the 18:3 level
RNA interference (RNAi) constructs for suppression of single or multiple FAD genes were introduced into rice plants (cv. Taichung 65) by Agrobacterium-mediated transformation. Gas chromatographic analysis showed that transgenic rice lines (F78Ri) harboring the OsFAD7–OsFAD8 RNAi construct contained the lowest levels of 18:3 in their leaves among all lines generated (Fig. 4A): the levels were reduced to approximately 13% of those in wild-type plants. In contrast, the 18:2 levels in F78Ri lines were 13-fold higher than those of wild-type plants. Strangely, transformation with the OsFAD3–OsFAD7–OsFAD8 RNAi construct did not result in lower 18:3 levels than those found in the F78Ri lines, suggesting that the complete loss of 18:3 is harmful or that some amount of 18:3 may be necessary for Agrobacterium-mediated transformation (Fig. 4A). In F78Ri lines, both OsFAD7 and OsFAD8 transcripts were barely detectable, whereas no changes were observed in the levels of OsFAD3 transcripts (Fig. 4B).
|
Fatty acids are acylated in lipids of various cellular membranes. Major membrane lipids in leaf tissues are galactolipids including monogalactosyldiacylglycerol (MGDG), digalactosyldiacylglycerol (DGDG) and sulfoquinovosyldiacylglycerol (SQDG), and phospholipids including phosphatidylethanolamine (PE), phosphatidylglycerol (PG), phosphatidylcholine (PC) and phosphatidylinositol (PI). To confirm that the composition of PUFAs in the lipids in F78Ri plants was altered, we determined the composition of acylated fatty acids in lipid species from leaf tissues of F78Ri and wild-type plants (Table 1). The 18:3 fatty acid precursor for JA is present mainly in MGDG and PC of chloroplast membrane lipids (Weber 2002
). We found that the 18:3 levels of all lipid classes were reduced in F78Ri leaves; the levels in MGDG and PC were lowered to 9.6 and 16.3% of the wild-type levels, respectively. Because the OsFAD3 gene, which encodes an enzyme that catalyzes the desaturation of extrachloroplast membrane lipids, was expressed normally (Fig. 4B), the percentage reduction was lower in PC than in MGDG.
|
At 3 weeks after sowing, F78Ri plants were significantly shorter than wild-type plants (Fig. 4C). Despite the inheritance of the OsFAD7–OsFAD8 RNAi transgene, only 51% of the F78Ri T1 progeny plants showed the alteration in the composition of PUFAs that was present in the primary transformants. We used the progeny plants with wild-type PUFA compositions (F78Ri-r) as additional negative controls. The height of the F78Ri-r plants was slightly reduced, to 94.2% of the wild type. Because JA is essential for pollen development, Arabidopsis JA-biosynthetic mutants exhibit a male-sterile phenotype (McConn and Browse 1996
, Stintzi et al. 2001. Park et al. 2002). However, the reduction in 18:3 levels in F78Ri rice plants did not influence their fertility. Normal fertility is also observed in the Arabidopsis fad7fad8 double mutant and the tomato spr2 mutant, in which TA levels are <5 mol% (McConn and Browse 1996, Li et al. 2003).
JA deficiency causes impaired wound responses in F78Ri plants
Wound stress induces a transient accumulation of JA in rice (Rakwal et al. 2002). To confirm the impairment of JA accumulation in F78Ri plants, the levels of JA and 18:3 in wounded leaves were examined (Fig. 5A, B). In wild-type leaves, JA levels transiently increased >60-fold after wounding, and this was accompanied by a reduction in 18:3 levels. These results indicate that 18:3 is a precursor for wound-induced JA biosynthesis in rice. On the other hand, the maximum JA level in wounded leaves of F78Ri plants was only 10% of that in wild-type plants, and 18:3 levels remained low, suggesting that the deficiency in 18:3 caused a reduction in the catalytic efficiency of JA biosynthesis.
|
Some wound-responsive genes are also activated by exogenous applications of JA and MeJA. To investigate the wound responsiveness in F78Ri plants, the expression of JAmyb, which encodes a Myb transcription factor, and of OsMAPK5, which encodes a mitogen-activated protein (MAP) kinase, was examined (Fig. 5C). Both JAmyb and OsMAPK5 are wound responsive, but only JAmyb is induced by JA (Lee et al. 2001
, Xiong and Yang 2003). We found that in wounded wild-type leaves, JAmyb mRNA increased within 30 min, reached a maximum at 2 h and then declined. The expression of JAmyb was strongly suppressed in F78Ri leaves. In contrast, the wound inducibility of OsMAPK5 was unaffected in F78Ri plants. To exclude the possibility that F78Ri plants are defective in JA signaling, the expression of JAmyb was examined in MeJA-treated leaves (Fig. 5D). JAmyb mRNA levels increased within 12 h after MeJA treatment, and continued to increase up to 24 h, in both wild-type and F78Ri plants. These results suggest that the JA-mediated responses to wounding are affected in F78Ri plants due to the impairment of JA accumulation.
Non-race-specific resistance to the rice blast fungus M. grisea is enhanced in F78Ri plants
In rice, some PR genes are induced by exogenous JA, and by inoculation with the rice blast fungus M. grisea. However, inoculation with M. grisea does not result in an accumulation of endogenous JA (Schweizer et al. 1997). To study the contribution of JA in the defense responses to M. grisea, the severity of the disease in three independent F78Ri T2 lines was assessed. Because of the morphological differences between wild-type and F78Ri plants (Fig. 4C), it is difficult to compare the degree of disease resistance in these plants using the popular spray inoculation method. Therefore, we used the spot inoculation technique. Three-week-old wild-type, F78Ri-r and F78Ri lines were inoculated with either the incompatible race 102, or the compatible race 001 of M. grisea. Seven days after inoculations, leaf lesions were classified into five levels of severity (Fig. 6). After the inoculation experiment, we measured the fatty acid contents of each transgenic progeny, and then categorized them into an 18:3 reduced group (F78Ri; <30 mol%) and a non-reduced group (F78Ri-r; >60 mol%). Unexpectedly, in spite of the impairment in JA biosynthesis in F78Ri plants, level 3 and 4 symptoms were not observed in these lines after inoculation with race 102, while level 3 and 4 symptoms did develop in the wild-type and F78Ri-r lines (Fig. 6B). Furthermore, the rates of level 3 and 4 symptoms in F78Ri lines after inoculation with race 001 were lower than those in the wild-type and F78Ri-r lines.
|
To quantify the severity of disease in F78Ri lines, lesion sizes were measured 7 d after inoculation (Fig. 6C). The mean diameter of scars resulting from mock inoculation was <1.2 mm in wild-type, F78Ri-r and F78Ri lines (data not shown). The mean lesion diameters were 6.1 ± 1.3 and 11.4 ± 1.8 mm in wild-type leaves inoculated with race 102 and race 001, respectively. The mean lesion diameters in the three F78Ri lines inoculated with race 102 and race 001 were significantly reduced to 69 and 54% of the wild-type values, respectively (P <0.04, t-test). In contrast, the lesion diameters in F78Ri-r lines were not significantly different from those in the wild-type plants (P > 0.1, t-test).
To investigate the relationship between the enhanced disease resistance and the impairment in JA biosynthesis in F78Ri plants, we treated leaves with MeJA vapor for 24 h before inoculation. The percentages of level 3 and 4 symptoms that developed after inoculation with either race 102 or race 001 were slightly reduced by MeJA pre-treatment in wild-type, F78Ri-r and F78Ri lines (Fig. 6B). In addition, the significant reduction of lesion sizes in all pre-treated lines was not observed (Fig. 6C; P > 0.1, t-test). Since the enhancement of resistance was observed in MeJA-pre-treated F78Ri lines after inoculation with either race 102 or race 001, the enhanced resistance in F78Ri plants seems not to be caused by the impairment in JA biosynthesis; rather it appeared that the deficiency of 18:3 may be involved.
Rapid expression of pathogenesis-related genes in F78Ri plants
The acquired resistance to M. grisea is often accompanied by the activation of a rice PR10 gene, PBZ1, and a rice basic PR1 gene, PR1b (Midoh and Iwata 1996, Xiong and Yang 2003). The expression of PBZ1 and PR1b in F78Ri was examined after inoculation with either race 102 or race 001 pathogens (Fig. 7). In wild-type leaves inoculated with either race 102 or race 001, the expression of these genes was transiently induced at 2 and 3 d, respectively, after inoculation. In contrast, in F78Ri leaves inoculated with either race 102 or race 001, the expression of these genes was induced earlier. Although the maximum levels of transcript accumulation were slightly reduced in F78Ri leaves inoculated with race 102, the expression continued over 3 d.
|
|
Discussion |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsAcknowledgmentsReferences |
|---|
We demonstrated that 18:3-deficient transgenic rice F78Ri plants showed enhanced resistance to both an incompatible and a compatible race of M. grisea (Figs. 4, 6). In Arabidopsis, fad3 fad7 fad8 mutants are susceptible to the fungal pathogen P. mastophorum, and the loss of resistance is restored by exogenous MeJA application (Vijayan et al. 1998
). In rice, some PR genes are induced by JA application (Schweizer et al. 1997, Agrawal et al. 2000, Kim et al. 2004). Recently, it has been reported that endogenous JA accumulation by overexpression of a JA biosynthetic gene in rice caused enhanced resistance to M. grisea (Mei et al. 2006). In our study, resistance to M. grisea was enhanced and JA-responsive PR genes were induced by the inoculation in F78Ri plants (Figs. 6, 7). However, the enhanced resistance in F78Ri plants was not affected by exogenous MeJA application (Fig. 6), suggesting that the resistance in F78Ri plants was enhanced by the deficiency of 18:3 or 18:3-derived oxylipins, but not of JA. These findings imply that PUFAs or oxylipins might have unique roles in defense responses in rice.
PUFAs, such as 18:3 and 18:2, are converted into various oxylipins via diverse metabolic pathways (Blée 2002, Howe and Schilmiller 2002). Some oxylipins have also been suggested to regulate defense responses. For example, C6 compounds derived from PUFAs induce resistance to the fungus Botrytis cinerea and expression of JA-responsive genes in Arabidopsis (Kishimoto et al. 2005). The composition of C6 compounds is abnormal in the Arabidopsis fad7 mutant (Zhuang et al. 1996), implying that the enhanced resistance in F78Ri plants may be attributed to changes in the oxylipin composition caused by the reduction of 18:3 levels. This raises the possibility that derivatives of 18:2 or 18:3 may act as positive or negative factors in defense responses in rice.
Hydroperoxy and hydroxy PUFAs have antifungal activities that inhibit the germination of conidia and the elongation of the germ tube of M. grisea (Kato et al. 1984). The hydroperoxydation of PUFAs is catalyzed by lipoxygenase; hydroperoxy PUFAs are further converted to the hydroxy PUFAs. The lipoxygenase is activated by inoculation with M. grisea in rice and preferentially catalyzes the hydroperoxydation of 18:2 rather than 18:3 (Ohta et al. 1991). Interestingly, both hydroperoxy and hydroxy 18:2 also exhibit antifungal activity in vitro against M. grisea (Ohta et al. 1991). In F78Ri leaves, 18:2 accumulated owing to the suppression of 18:2 desaturation (Fig. 4, Table 1). As a consequence, antifungal oxylipins derived from 18:2 may abundantly accumulate in F78Ri plants and inhibit the growth of incompatible and compatible races of M. grisea.
In conclusion, we show that the deficiency of 18:3 in rice enhances the non-race-specific resistance to M. grisea. In addition to JA, various oxylipins derived from PUFAs may play important roles as signaling molecules or antifungal agents in defense responses in rice, although we cannot yet identify oxylipins that contribute to the resistance to fungal infection. In recent years, rice PUFA metabolic pathways have been elucidated following the isolation of genes encoding the metabolic enzymes (Koeduka et al. 2000, Agrawal et al. 2004, Kuroda et al. 2005). Thus, in the near future, a series of oxylipin-deficient transgenic rice plants may be available for further investigations. Moreover, advanced methods are being developed to determine levels of individual oxylipins (Montillet et al. 2004, Mueller et al. 2006). The functions of individual oxylipins will become important themes for understanding disease resistance in plants.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsAcknowledgmentsReferences |
|---|
Cloning and sequencing of OsFAD7 and OsFAD8
A novel cDNA fragment was found in a BLAST search of the rice full-length cDNA database KOME (http://cdna01.dna.affrc.go.jp/cDNA/), using the Arabidopsis FAD7 cDNA sequence, and was named OsFAD7. The cDNA and genomic clones of OsFAD7 and OsFAD8 were amplified by PCR from rice (Oryza sativa cv. Taichung 65). The primer sequences for OsFAD7 were 5'-CTGCCGGCGCCTYCCAGCCTCGCCGSGGGG and 5'-GCTAGAGACTAATGTTCTGTCAATCCGAGC; and for OsFAD8 were 5'-CGCGCCATTGCATTTGCGCTCCCACTTGGG and 5'-ATCTAATTAAGCTAATTTAAGCCTCCGGGC. The 5' and 3' ends of the OsFAD7 cDNAs were determined using the SMART RACE cDNA amplification kit (Clontech, Palo Alto, CA, USA) according to the manufacturer's instructions. The sequences of the 5'- and 3'-RACE primers were 5'-GGCCGCAGCACTCGGAGAGGACGAGCCGTG and 5'-CAGCGACCACTATGTTAGTGACGCCGGAG, respectively, for OsFAD7; and 5'-GGGGAGCGGCGCGACGCCGGAGAG and 5'-GGAGCGCTGTCCCGGAGCTTGAAACGCG, respectively, for OsFAD8. The amplified PCR products were cloned into the pGEM-T easy vector (Promega, Madison, WI, USA), and were sequenced using the BigDye terminator version 3.0 cycle sequencing kit and the ABI PRISM 3100 genetic analyzer (Applied Biosystems, Foster City, CA, USA).
Gene constructs and rice transformation
For the construction of a suppression vector targeted to both OsFAD7 and OsFAD8, an RNAi construct was designed as described previously (Chuang and Meyerowitz 2000). Antisense (AS8) and sense (S8) fragments were amplified from the OsFAD8 cDNA using primers for AS8 (5'-GCTCTAGAGCACAAAAATCCAGTAAGGGAC, XbaI site underlined; and 5'-CGGGATCCCGTCCTGGCATCCCCTCCCCG, BamHI site underlined), and S8 (5'-GGCGCGCCGTCCTGGCATCCCCTCCCCGAGCGGCTGTACAGGAGCCTTAAC, AscI site underlined; and 5'-CGAGCTCGACAAAAATCCAGTAAGGGAC, SacI site underlined). The linker (L8) fragment was amplified from the ß-glucuronidase (GUS) gene of the pIG121Hm Ti-vector (Hiei et al. 1994) with primers for L8 (5'-CGCGGATCCGCGGATATCTACCCGCTTCGCGTCG, BamHI site underlined; and 5'-TTGGCGCGCCAATTGTTTGCCTCCCTGCTGCGG, AscI site underlined). The amplified AS8, L8 and S8 fragments were cleaved at the prepared restriction sites and inserted together into the XbaI–SacI site of the pIG121Hm, after removal of the intron-GUS gene, to produce pBIF8Ri. Subsequently, antisense (AS7) and sense (S7) fragments were amplified from the OsFAD7 cDNA using primers for AS7 (5'-GCTCTAGAGCCACATAACAAATATCACGTATG, XbaI site underlined; and 5'-CGCGGATCCGCGCAACCGCTGTCTGAGAGGCTG, BamHI site underlined) and for S7 (5'-TTGGCGCGCCAACCGCTGTCTGAGAGGCTG, AscI site underlined; and 5'-GTGGGCCCACATAACAAATATCACGTATG, ApaI site underlined). The cauliflower mosaic virus (CaMV) 35S promoter fragment was amplified from pIG121Hm using the primers 5'-GGTTTAAACCTGCAGGTCCCCAGATTAGCC (PmeI site underlined) and 5'-TCTAGAGTCCCCCGTGTTCTC (XbaI site underlined). The linker (L7) fragment was amplified from the luciferase gene of the pBILUCHm vector (Yara et al. 2001) using the primers 5'-CGCGGATCCGCTGGAAGATGGAACCGCTGG (BamHI site underlined) and 5'-TTGGCGCGCCCGGTTTATCATCCCCCTCGG (AscI site underlined). The amplified 35S, AS7, L7 and S7 fragments were cleaved at the prepared restriction sites and inserted together into the PmeI–ApaI site of pBIF8Ri, after removal of the NOS promoter and the NPTII gene, to produce pBIF78Ri. Wild-type rice (cv. Taichung 65) was transformed with pBIF78Ri by Agrobacterium-mediated transformation (Yara et al. 2001).
RNA isolation and expression analysis
Total RNA was isolated using the TRIZOL reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. RNA gel blot analysis of PBZ1, PR1b, JAmyb and OsMAPK5 was performed as described previously (Kusumi and Iba 1998). Specific probes for these genes were amplified by PCR, using primers for PBZ1 (5'-CTACAGGCATCAGTGGTCAGTA and 5'-TCATCTTAGGCGTATTCGGCAG), PR1b (5'-TGGAGGTATCCAAGCTGGCC and 5'-TTAGTAAGGCCTCTGTCCGA), JAmyb (5'-ACCCGGTGCCCGGGGAGCAGC and 5'-GTGCTATCTTGGACCATCGGTTG) and OsMAPK5 (5'-GCGTTCAACAACGACATGGACG and 5'-GTTGGCGTTCAGCAGCAGGTTG). For the expression analysis of FAD genes, semi-quantitative reverse transcription–PCR analysis was performed as described previously (Sugimoto et al. 2004), using primers for OsFAD7 (5'-CCATACCACGGCTGGAGGAT and 5'-GCAGATAGCTCCACTCCTTTCC), OsFAD8 (5'-CCTCGGCCACGACTGCGGGC and 5'-CCCCGCAAATAGCTCCATTCCTTGCC) and OsFAD3 (5'-CCCCTACCATGGATGGAGGT and 5'-GAGGTAGCTCCATTCCTCTCC).
Wound and chemical treatment
For wound treatment, the third leaves of 2-week-old rice plants were cut into 5 mm long sections with scissors and then were floated on 50 mM sodium phosphate buffer, pH 7.0, at 28°C under continuous light. To test the effects of exogenous JA, 2-week-old plants were sprayed with a 100 µM JA (Wako Pure Chemical, Osaka, Japan) solution containing 0.01% dimethyl sulfoxide (DMSO) and 0.1% Tween-20, and maintained at 28°C under continuous light. Control plants were treated with 0.01% DMSO and 0.1% Tween-20 only. Alternatively, 2- or 3-week-old plants were exposed to MeJA vapor for 24 h by placing them in an airtight container with four cotton balls soaked in 100 ml of a 500 µM MeJA (Wako Pure Chemical, Osaka, Japan) solution containing 0.05% DMSO. Control plants were treated with 0.05% DMSO only in separate containers. Northern analysis and inoculation with M. grisea were performed after MeJA treatment.
Lipid and fatty acid analysis
Glycerolipids were extracted and separated into lipid classes as described previously (Miquel and Browse 1992). The fatty acid compositions in leaves and in the individual lipid classes were determined as detailed previously (Kodama et al. 1994).
Quantification of JA
Tissue samples were ground in liquid nitrogen with a mortar and pestle and then mixed with 70% methanol. [2H2](±)-JA was added to the extract as an internal standard. The extracts were centrifuged at 10,000xg for 10 min and the supernatant was passed through a Strata C18-E (200 mg/3 ml) cartridge (Phenomenex, Torrance, CA, USA). Then, 0.1 ml of the eluate were injected into an 1100 HPLC instrument (Agilent Technologies, Palo Alto, CA, USA) equipped with a Sciex API300 LC-MS-MS system (Applied Biosystems, Foster City, CA, USA). The analytes were separated on an Inertsil ODS-2 column (2.1 mm, i.d. x 150 mm, GL Sciences, Tokyo, Japan). Elution was performed using the solvent systems A, 0.1% (v/v) formic acid in water, and B, 0.1% (v/v) formic acid in acetonitrile as follows: 0–5 min, 5% B in A; 5–10 min, linear gradient from 5% B to 100% B in A; 10–15 min, 100% B. The flow rate was 0.2 ml min–1. The MS–MS analysis was carried out in the negative ion mode with a turboionspray inlet system as described previously (Tamogami and Kodama 1998). JA and [2H2](±)-JA were detected in combination at m/z 209/59 and 211/59, respectively, in the multiple reaction-monitoring mode.
Inoculation of plants with the blast fungus M. grisea
Race 102 (84-107B) and race 001 (kyu91-107) of M. grisea were pre-cultured under continuous light conditions at 23°C for 3 d in yeast extract–dextrose (YD) medium (5 g l–1 yeast extract and 20 g l–1 dextrose). Subsequently, the fungi were grown on oatmeal agar (Difco, Detroit, MI, USA) containing 16.5 g l–1 sucrose for 7 d under continuous light, and then spore formation was induced for 3 d under light. Fully expanded third leaves of 3-week-old rice plants were inoculated. Inoculation was performed on 1 mm diameter press-injured spots made with a specially designed press (Fujiwara Scientific Company, Tokyo, Japan). A 5 µl aliquot of spore suspension (3 x 105 conidia ml–1) containing 0.2% carboxymethyl cellulose was placed on these injured spots. The inoculated plants were incubated at 23°C in an airtight container in the dark for 20 h, and then at 28°C in the light. The inoculated leaves were harvested at the indicated time points. Exposure to MeJA vapor took place 24 h before inoculation with M. grisea. Seven days after inoculation, the leaf lesions were classified into five levels of disease severity as follows. Level 0, when M. grisea infection had failed, the inoculation spot became a small white scar, similar to a mock inoculation; level 1, a small dark-brown lesion had formed at the inoculation spot; level 2, the dark-brown lesion had spread and surrounded the inoculation spot; level 3, small chlorotic and stunted regions had formed around the dark-brown lesion; and level 4, chlorotic and stunted regions had spread across the whole leaves.
|
Acknowledgments |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsAcknowledgmentsReferences |
|---|
We thank Hiroyuki Ohta (Tokyo Institute of Technology) and Yuko Ohashi (National Institute of Agrobiological Sciences) for helpful discussions. We are also grateful to Nagao Hayashi (National Institute of Agrobiological Sciences) for technical consultation regarding lesion analysis. We thank Ritsuko Mizobuchi for providing 84-107B and kyu91-107 strains and experimental advice. This research was supported by CREST, JST and the Ministry of Agriculture, Forestry and Fisheries of Japan (Rice Genome Project IP-5005) and the Japan Society of the Promotion of Science (17370019) grants.
|
Footnotes |
|---|
The nucleotide sequences reported in this paper have been submitted to the DDBJ data library under the following accession numbers: OsFAD7, AB232382; OsFAD8, AB232383; OsFAD3, D78505; JAmyb, AY026332; OsMAPK5, AF479883; PBZ1, D38170; and PR1b, U89895.
|
References |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsAcknowledgmentsReferences |
|---|
Agrawal GK, Jwa N-S, Shibato J, Han O, Iwahashi H, Rakwal R. Diverse environmental cues transiently regulate OsOPR1 of the ‘octadecanoid pathway’ revealing its importance in rice defense/stress and development. Biochem. Biophys. Res. Commun. (2003) 310:1073–1082.[CrossRef][Web of Science][Medline]
Agrawal GK, Rakwal R, Jwa N-S. Rice (Oryza sativa L.) OsPR1b gene is phytohormonally regulated in close interaction with light signals. Biochem. Biophys. Res. Commun. (2000) 278:290–298.[CrossRef][Web of Science][Medline]
Agrawal GK, Tamogami S, Han O, Iwahashi H, Rakwal R. Rice octadecanoid pathway. Biochem. Biophys. Res. Commun. (2004) 317:1–15.[CrossRef][Web of Science][Medline]
Arondel V, Lemieux B, Hwang I, Gibson S, Goodman HM, Somerville CR. Map-based cloning of a gene controlling omega-3 fatty acid desaturation in Arabidopsis. Science (1992) 258:1353–1355.
Blée E. Impact of phyto-oxylipins in plant defense. Trends Plant Sci. (2002) 7:315–322.[CrossRef][Web of Science][Medline]
Chuang C-F, Meyerowitz EM. Specific and heritable genetic interference by double-stranded RNA in Arabidopsis thaliana. Proc. Natl Acad. Sci. USA (2000) 97:4985–4990.
Gibson S, Arondel V, Iba K, Somerville C. Cloning of a temperature-regulated gene encoding a chloroplast -3 desaturase from Arabidopsis thaliana. Plant Physiol. (1994) 106:1615–1621.[Abstract]
Haga K, Iino M. Phytochrome-mediated transcriptional up-regulation of ALLENE OXIDE SYNTHASE in rice seedlings. Plant Cell Physiol. (2004) 45:119–128.
Howe GA, Schilmiller AL. Oxylipin metabolism in response to stress. Curr. Opin. Plant Biol. (2002) 5:230–236.[CrossRef][Web of Science][Medline]
Hiei Y, Ohta S, Komari T, Kumashiro T. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J. (1994) 6:271–282.[CrossRef][Web of Science][Medline]
Iba K. Acclimative response to temperature stress in higher plants: approaches of gene engineering for temperature tolerance. Annu. Rev. Plant Biol. (2002) 53:225–245.[CrossRef][Medline]
Iba K, Gibson S, Nishiuchi T, Fuse T, Nishimura M, Arondel V, Hugly S, Somerville C. A gene encoding a chloroplast -3 fatty acid desaturase complements alterations in fatty acid desaturation and chloroplast copy number of the fad7 mutant of Arabidopsis thaliana. J. Biol. Chem. (1993) 268:24099–24105.
Kato T, Yamaguchi Y, Hirano T, Yokoyama T, Uyehara T, Namai T, Yamanaka S, Harada N. Unsaturated hydroxy fatty acids, the self defensive substances in rice plant against rice blast disease. Chem. Lett. (1984) 13:409–412.
Kim ST, Kim SG, Hwang DH, Kang SY, Kim HJ, Lee BH, Lee JJ, Kang KY. Proteomic analysis of pathogen-responsive proteins from rice leaves induced by rice blast fungus, Magnaporthe grisea. Proteomics (2004) 4:3569–3578.[CrossRef][Web of Science][Medline]
Kishimoto K, Matsui K, Ozawa R, Takabayashi J. Volatile C6-aldehydes and Allo-ocimene activate defense genes and induce resistance against Botrytis cinerea in Arabidopsis thaliana. Plant Cell Physiol. (2005) 46:1093–1102.
Kodama H, Akagi H, Kusumi K, Fujimura T, Iba K. Structure, chromosomal location and expression of a rice gene encoding the microsome -3 fatty acid desaturase. Plant Mol. Biol. (1997) 33:493–502.[CrossRef][Web of Science][Medline]
Kodama H, Hamada T, Horiguchi G, Nishimura M, Iba K. Genetic enhancement of cold tolerance by expression of a gene for chloroplast -3 fatty acid desaturase in transgenic tobacco. Plant Physiol. (1994) 105:601–605.[Abstract]
Koeduka T, Matsui K, Akakabe Y, Kajiwara T. Molecular characterization of fatty acid 
-hydroperoxide-forming enzyme (-oxygenase) in rice plants. Biochem. Soc. Trans. (2000) 28:765–768.[CrossRef][Web of Science][Medline]
Kuroda H, Oshima T, Kaneda H, Takashio M. Identification and functional analyses of two cDNAs that encode fatty acid 9-/13-hydroperoxide lyase (CYP74C) in rice. Biosci. Biotechnol. Biochem. (2005) 69:1545–1554.[CrossRef][Medline]
Kusumi J, Iba K. Characterization of a nonsense mutation in fad7, the gene which encodes -3 desaturase in Arabidopsis thaliana. J. Plant Res. (1998) 111:87–91.[CrossRef][Web of Science]
Lee M-W, Qi M, Yang Y. A novel jasmonic acid-inducible rice myb gene associates with fungal infection and host cell death. Mol. Plant-Microbe Interact. (2001) 14:527–535.[Web of Science][Medline]
Li C, Liu G, Xu C, Lee GI, Bauer P, Ling H-Q, Ganal MW, Howe GA. The tomato suppressor of prosystemin-mediated responses2 gene encodes a fatty acid desaturase required for the biosynthesis of jasmonic acid and the production of a systemic wound signal for defense gene expression. Plant Cell (2003) 15:1646–1661.
McConn M, Browse J. The critical requirement for linolenic acid is pollen development, not photosynthesis, in an Arabidopsis mutant. Plant Cell (1996) 8:403–416.[Abstract]
McConn M, Creelman RA, Bell E, Mullet JE, Browse J. Jasmonate is essential for insect defense in Arabidopsis. Proc. Natl Acad. Sci. USA (1997) 94:5473–5477.
Mei C, Qi M, Sheng G, Yang Y. Inducible overexpression of a rice allene oxide synthase gene increases the endogenous jasmonic acid level, PR gene expression, and host resistance to fungal infection. Mol. Plant-Microbe. Interact. (2006) 19:1127–1137.[CrossRef][Web of Science][Medline]
Midoh N, Iwata M. Cloning and characterization of a probenazole-inducible gene for an intracellular pathogenesis-related protein in rice. Plant Cell Physiol. (1996) 37:9–18.
Miquel M, Browse J. Arabidopsis mutants deficient in polyunsaturated fatty acid synthesis. Biochemical and genetic characterization of a plant oleoyl-phosphatidylcholine desaturase. J. Biol. Chem. (1992) 267:1502–1509.
Montillet J-L, Cacas J-L, Garnier L, Montané M-H, Douki T, Bessoule J-J, Polkowska-Kowalczyk L, Maciejewska U, Agnel J-P, Vial A, Triantaphylidès C. The upstream oxylipin profile of Arabidopsis thaliana: a tool to scan for oxidative stresses. Plant J. (2004) 40:439–451.[CrossRef][Web of Science][Medline]
Mueller MJ, Mène-Saffrané L, Grun C, Karg K, Farmer EE. Oxylipin analysis methods. Plant J. (2006) 45:472–489.[CrossRef][Web of Science][Medline]
Nishiuchi T, Hamada T, Kodama H, Iba K. Wounding changes the spatial expression pattern of the Arabidopsis plastid -3 fatty acid desaturase gene (FAD7) through different signal transduction pathways. Plant Cell (1997) 9:1701–1712.[Abstract]
Nishiuchi T, Nakamura T, Abe T, Kodama H, Nishimura M, Iba K. Tissue-specific and light-responsive regulation of the promoter region of the Arabidopsis thaliana chloroplast -3 fatty acid desaturase gene (FAD7). Plant Mol. Biol. (1995) 29:599–609.[CrossRef][Web of Science][Medline]
Ohta H, Shida K, Peng Y-L, Furusawa I, Shishiyama J, Aibara S, Morita Y. A lipoxygenase pathway is activated in rice after infection with the rice blast fungus Magnaporthe grisea. Plant Physiol. (1991) 97:94–98.
Park J-H, Halitschke R, Kim HB, Baldwin IT, Feldmann KA, Feyereisen R. A knock-out mutation in allene oxide synthase results in male sterility and defective wound signal transduction in Arabidopsis due to a block in jasmonic acid biosynthesis. Plant J. (2002) 31:1–12.[CrossRef][Web of Science][Medline]
Penninckx IAMA, Eggermont K, Terras FR, Thomma BPHJ, De Samblanx GW, Buchala A, Métraux J-P, Manners JM, Broekaert WF. Pathogen-induced systemic activation of a plant defensin gene in Arabidopsis follows a salicylic acid-independent pathway. Plant Cell (1996) 8:2309–2323.[Abstract]
Rakwal R, Tamogami S, Agrawal GK, Iwahashi H. Octadecanoid signaling component ‘burst’ in rice (Oryza sativa L.) seedling leaves upon wounding by cut and treatment with fungal elicitor chitosan. Biochem. Biophys. Res. Commun. (2002) 295:1041–1045.[CrossRef][Web of Science][Medline]
Sasaki Y, Asamizu E, Shibata D, Nakamura Y, Kaneko T, et al. Monitoring of methyl jasmonate-responsive genes in Arabidopsis by cDNA macroarray: self-activation of jasmonic acid biosynthesis and crosstalk with other phytohormone signaling pathways. DNA Res. (2001) 8:153–161.[Abstract]
Schweizer P, Buchala A, Silverman P, Seskar M, Raskin I, Métraux J-P. Jasmonate-inducible genes are activated in rice by pathogen attack without a concomitant increase in endogenous jasmonic acid levels. Plant Physiol. (1997) 114:79–88.[Abstract]
Seo S, Okamoto M, Seto H, Ishizuka K, Sano H, Ohashi Y. Tobacco MAP kinase: a possible mediator in wound signal transduction pathways. Science (1995) 270:1988–1992.
Stenzel I, Hause B, Miersch O, Kurz T, Maucher H, Weichert H, Ziegler J, Feussner I, Wasternack C. Jasmonate biosynthesis and the allene oxide cyclase family of Arabidopsis thaliana. Plant Mol. Biol. (2003) 51:895–911.[CrossRef][Web of Science][Medline]
Stintzi A, Weber H, Reymond P, Browse J, Farmer EE. Plant defense in the absence of jasmonic acid: the role of cyclopentenones. Proc. Natl Acad. Sci. USA (2001) 98:12837–12842.
Strassner J, Schaller F, Frick UB, Howe GA, Weiler EW, Amrhein N, Macheroux P, Schaller A. Characterization and cDNA-microarray expression analysis of 12-oxophytodienoate reductases reveals differential roles for octadecanoid biosynthesis in the local versus the systemic wound response. Plant J. (2002) 32:585–601.[CrossRef][Web of Science][Medline]
Sugimoto H, Kusumi K, Tozawa Y, Yazaki J, Kishimoto N, Kikuchi S, Iba K. The virescent-2 mutation inhibits translation of plastid transcripts for the plastid genetic system at an early stage of chloroplast differentiation. Plant Cell Physiol. (2004) 45:985–996.
Tamogami S, Kodama O. Quantification of amino acid conjugates of jasmonic acid in rice leaves by high-performance liquid chromatography–turboionspray tandem mass spectrometry. J. Chromatogr. A (1998) 822:310–315.[CrossRef][Web of Science]
Toriyama S, Hinata K, Nishida I, Murata N. Prominent difference of glycerolipids among anther walls, pollen grains and leaves of rice and maize. Plant Cell Physiol. (1988) 29:615–621.
Turner JG, Ellis C, Devoto A. The jasmonate signal pathway. Plant Cell (2002) 14(suppl):S153–S164.
Vijayan P, Shockey J, Lévesque CA, Cook RJ, Browse J. A role for jasmonate in pathogen defense of Arabidopsis. Proc. Natl Acad. Sci. USA (1998) 95:7209–7214.
Wang J, Ming F, Pittman J, Han Y, Hu J, Guo B, Shen D. Characterization of a rice (Oryza sativa L.) gene encoding a temperature-dependent chloroplast -3 fatty acid desaturase. Biochem. Biophys. Res. Commun. (2006) 340:1209–1216.[CrossRef][Web of Science][Medline]
Weber H. Fatty acid-derived signals in plants. Trends Plant Sci. (2002) 7:217–224.[CrossRef][Web of Science][Medline]
Xiong L, Yang Y. Disease resistance and abiotic stress tolerance in rice are inversely modulated by an abscisic acid-inducible mitogen-activated protein kinase. Plant Cell (2003) 15:745–759.
Yaeno T, Matsuda O, Iba K. Role of chloroplast trienoic fatty acids in plant disease defense responses. Plant J. (2004) 40:931–941.[CrossRef][Web of Science][Medline]
Yara A, Otani M, Kusumi K, Matsuda O, Shimada T, Iba K. Production of transgenic japonica rice (Oryza sativa) cultivar, Taichung 65, by the Agrobacterium-mediated method. Plant Biotechnol. (2001) 18:305–310.
Zhuang H, Hamilton-Kemp TR, Andersen RA, Hildebrand DF. The impact of alteration of polyunsaturated fatty acid levels on C6-aldehyde formation of Arabidopsis thaliana leaves. Plant Physiol. (1996) 111:805–812.[Abstract]
(Received July 6, 2007; Accepted August 7, 2007)
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  T. Yaeno and K. Iba BAH1/NLA, a RING-Type Ubiquitin E3 Ligase, Regulates the Accumulation of Salicylic Acid and Immune Responses to Pseudomonas syringae DC3000 Plant Physiology, October 1, 2008; 148(2): 1032 - 1041. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||